Review



plko 3 thy1 1 cd90 1 vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 91
      Buy from Supplier

    Structured Review

    Addgene inc plko 3 thy1 1 cd90 1 vector
    Plko 3 Thy1 1 Cd90 1 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 3 thy1 1 cd90 1 vector/product/Addgene inc
    Average 91 stars, based on 4 article reviews
    plko 3 thy1 1 cd90 1 vector - by Bioz Stars, 2026-05
    91/100 stars

    Images



    Similar Products

    plko 3 thy1 1 cd90 1 vector  (Addgene inc)
    91
    Addgene inc plko 3 thy1 1 cd90 1 vector
    Plko 3 Thy1 1 Cd90 1 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 3 thy1 1 cd90 1 vector/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    plko 3 thy1 1 cd90 1 vector - by Bioz Stars, 2026-05
    91/100 stars
    		  Buy from Supplier
    plko 3  (Addgene inc)
    93
    Addgene inc plko 3
    Plko 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 3/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    plko 3 - by Bioz Stars, 2026-05
    93/100 stars
    		  Buy from Supplier
    thy1 1 plasmid  (Addgene inc)
    93
    Addgene inc thy1 1 plasmid
    Thy1 1 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/thy1 1 plasmid/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    thy1 1 plasmid - by Bioz Stars, 2026-05
    93/100 stars
    		  Buy from Supplier
    paper n a plko 3  (Addgene inc)
    93
    Addgene inc paper n a plko 3
    Paper N A Plko 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/paper n a plko 3/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    paper n a plko 3 - by Bioz Stars, 2026-05
    93/100 stars
    		  Buy from Supplier
    cagacgcgtttagccctcccacacataaccaga 3  (Addgene inc)
    94
    Addgene inc cagacgcgtttagccctcccacacataaccaga 3
    Cagacgcgtttagccctcccacacataaccaga 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cagacgcgtttagccctcccacacataaccaga 3/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    cagacgcgtttagccctcccacacataaccaga 3 - by Bioz Stars, 2026-05
    94/100 stars
    		  Buy from Supplier
    caga cgcgttta gccctccca ca ca t aa cca ga 3  (Addgene inc)
    94
    Addgene inc caga cgcgttta gccctccca ca ca t aa cca ga 3
    Caga Cgcgttta Gccctccca Ca Ca T Aa Cca Ga 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/caga cgcgttta gccctccca ca ca t aa cca ga 3/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    caga cgcgttta gccctccca ca ca t aa cca ga 3 - by Bioz Stars, 2026-05
    94/100 stars
    		  Buy from Supplier
    26701 5 cctaaggttaagtcgccctcg 3  (Addgene inc)
    93
    Addgene inc 26701 5 cctaaggttaagtcgccctcg 3
    26701 5 Cctaaggttaagtcgccctcg 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/26701 5 cctaaggttaagtcgccctcg 3/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    26701 5 cctaaggttaagtcgccctcg 3 - by Bioz Stars, 2026-05
    93/100 stars
    		  Buy from Supplier

    Image Search Results